Brick Plot

A brick plot displays sequences as rows of colored rectangles — one brick per character. It is designed for bioinformatics workflows involving DNA/RNA sequence visualization and tandem-repeat structure analysis. Each character maps to a color defined by a template; rows are labeled on the y-axis.

Import paths: kuva::plot::BrickPlot, kuva::plot::brick::BrickTemplate

DNA sequences

BrickTemplate::dna() provides a standard A / C / G / T color scheme. Pass the .template field to BrickPlot::with_template(). Use with_x_offset(n) to skip a common flanking region so the region of interest starts at x = 0.

#![allow(unused)]
fn main() {
use std::collections::HashMap;
use kuva::plot::BrickPlot;
use kuva::plot::brick::BrickTemplate;
use kuva::backend::svg::SvgBackend;
use kuva::render::render::render_multiple;
use kuva::render::layout::Layout;
use kuva::render::plots::Plot;

let tmpl = BrickTemplate::new().dna();

let plot = BrickPlot::new()
    .with_sequences(vec![
        "CGGCGATCAGGCCGCACTCATCATCATCATCATCATCAT",
        "CGGCGATCAGGCCGCACTCATCATCATCATCATCATCATCAT",
    ])
    .with_names(vec!["read_1", "read_2"])
    .with_template(tmpl.template)
    .with_x_offset(18.0);  // skip 18-base common prefix

let plots = vec![Plot::Brick(plot)];
let layout = Layout::auto_from_plots(&plots)
    .with_title("DNA Repeat Region");

let svg = SvgBackend.render_scene(&render_multiple(plots, layout));
std::fs::write("brick.svg", svg).unwrap();
}

The 18-character flanking prefix is hidden by with_x_offset(18.0). All rows start at the same x = 0, aligning the CAT repeat region across reads.

Per-row offsets

When reads begin at different positions, with_x_offsets accepts one offset per row. Pass None for any row that should fall back to the global x_offset.

#![allow(unused)]
fn main() {
use kuva::plot::BrickPlot;
use kuva::plot::brick::BrickTemplate;
use kuva::render::plots::Plot;
let plot = BrickPlot::new()
    .with_sequences(sequences)
    .with_names(names)
    .with_template(BrickTemplate::new().dna().template)
    .with_x_offset(12.0)                       // global fallback
    .with_x_offsets(vec![
        Some(18.0_f64),  // read 1: skip 18
        Some(10.0),      // read 2: skip 10
        Some(16.0),      // read 3: skip 16
        Some(5.0),       // read 4: skip 5
        None,            // read 5: use global (12)
    ]);
}

Each row is shifted independently, aligning the repeat boundary across reads with different flanking lengths.

Custom template with value overlay

with_template accepts any HashMap<char, String>. Here a protein secondary-structure alphabet (H, E, C, T) gets custom colors. with_values() prints the character label inside each brick.

#![allow(unused)]
fn main() {
use std::collections::HashMap;
use kuva::plot::BrickPlot;
use kuva::render::plots::Plot;

let mut tmpl: HashMap<char, String> = HashMap::new();
tmpl.insert('H', "steelblue".into());   // α-helix
tmpl.insert('E', "firebrick".into());   // β-strand
tmpl.insert('C', "#aaaaaa".into());     // coil
tmpl.insert('T', "seagreen".into());    // turn

let plot = BrickPlot::new()
    .with_sequences(vec!["CCCHHHHHHHHHHCCCCEEEEEECCC"])
    .with_names(vec!["prot_1"])
    .with_template(tmpl)
    .with_values();  // show letter labels inside bricks
}

Any single-character alphabet can be used — amino acids, repeat unit categories, chromatin states, etc.

Strigar mode (tandem-repeat motifs)

with_strigars switches to strigar mode for structured tandem-repeat data produced by BLADERUNNER. Each read is described by two strings:

• motif string — maps local letters to k-mers: "CAT:A,C:B,T:C"
• strigar string — run-length encoding of those letters: "10A1B4A1C1A"

with_strigars normalises k-mers across all reads by canonical rotation, assigns global letters (A, B, C, …) by frequency, auto-generates colors, and renders variable-width bricks proportional to each motif's nucleotide length.

#![allow(unused)]
fn main() {
use kuva::plot::BrickPlot;
use kuva::render::plots::Plot;
let strigars: Vec<(String, String)> = vec![
    ("CAT:A,C:B,T:C".to_string(),   "10A1B4A1C1A".to_string()),
    ("CAT:A,T:B".to_string(),        "14A1B1A".to_string()),
    ("CAT:A,C:B,GGT:C".to_string(), "10A1B8A1C5A".to_string()),
    // ...
];

let plot = BrickPlot::new()
    .with_names(names)
    .with_strigars(strigars);  // sequences not needed — derived from strigars
}

Bricks are proportional to motif length (CAT = 3 bp wide; single-nucleotide interruptions are narrower). The dominant repeat unit (CAT) is assigned letter A and the first color; rarer motifs receive subsequent letters and colors.

Built-in templates

Access the populated map via .template and pass it to with_template().

API reference